|
PhyloGibbs Algorithm − A Gibbs motif sampler incorporating phylogeny and tracking statistics. |
|
PhyloGibbs is a motif finding algorithm that uses a Gibbs sampling strategy, takes the phylogenetic relationships of the input sequences rigorously into account, and assigns realistic posterior probabilities to reported sites using a novel annealing+tracking strategy. The phylogibbs(1) manpage gives detailed instructions on using the program; this page attempts to give an overview of the internal workings of the algorithm, which should clarify the meaning of many of the options described in the manual page. |
|
The idea of the Gibbs sampler is to sample the space of all possible "binding site configurations" that can be assigned to the input data. A binding site configuration is an assignment of a set of non-overlapping "windows" to input sequences, together with a assignment of "colors" to each of the windows. All windows of the same color are considered sites for the same "motif". Binding site configurations are scored by assuming that all sites belonging to the same motif, i.e. that are colored the same, were drawn from a common weight matrix. All parts of the sequences not in colored windows are scored according to a "background model". The program assumes that all binding sites have a fixed length w that must be specified on the command line via the −m option. The input sequence set is parsed into a set of all possible "windows". In the phylogenetically-unrelated case, a window is just a set of w adjacent bases on a sequence. In the phylogenetically aligned case, a window can extend across multiple sequences; this is discussed below. Having built up a list of all possible windows, as well as detailed pointer structures telling us how windows can block other windows (due to overlapping sites), we proceed to "select" and "unselect" these windows by giving them "colours": "colour 0" means not selected, and colours 1, 2, ... correspond to distinct motifs. For example, given a sequence as follows, |
> Seq 1 ACGATAGATGCGTGATGATATGCCCACAATAATACCCATGTGAGTGATTAATATAG ^^^^^^^^ ^^^^^^^^ ~~~~~~~~ ~~~~~~~~ |
|
the sequence is 56 bases long and the chosen motif width w is 8: thus we have 49 possible windows, starting at sites 0 through 48 inclusive. The windows underlined with ^^^^^^^^ have colour 1, the windows underlined with ~~~~~~~~ have colour 2, and all other possible windows have colour 0. Thus, the above is an example of a binding site configuration containing 4 sites in total for 2 motifs. Each "configuration" has a "score", which is the posterior probability of the configuration given the sequence; by Bayes’ theorem, assuming a flat prior on configurations, this is proportional to the probability of seeing the sequence given the configuration. This is the probability that the windows were sampled from weight matrices, multiplied by the probability that the rest of the sequence was sampled from background. We normalise by the probability that the entire sequence was sampled from background. We sample the space of all configurations. An initial simulated-anneal phase seeks the best-scoring configuration, that is, the configuration that best explains the sequence. A tracking phase then assesses the significance of the "clusters of sites" found in the simulated anneal, by keeping statistics of how often each window is a part of each cluster). The details of the scoring are beyond the scope of this manpage; consult the references. |
|
To account for phylogeny, we first run the input sequences through a multiple-alignment program (such as Dialign) to identify conserved blocks. PhyloGibbs then parses the resulting multi-fasta sequence into "windows": in unaligned regions, windows are just the same as before, but in aligned regions (where there are uppercase letters with matching vertical positions), we assume that any putative motif on one of those sequences in that region is not independent but has evolved with the other sequences from an ancestral motif. We therefore select this entire "aligned block" as a single window, and score it as a whole (again, the details of scoring are beyond the scope of this manpage). The sampling proceeds just as in the non-aligned case; the only difference is that windows may sometimes extend over multiple sequences, and be scored differently. |
> Seq 1 ACGATAGAtgcgtacga---atgCCACAATAA----gactagAGTG-TTAC-- ===2==== ---1---- ****3**** > Seq 2 ACGATAGA---------------CCACAATAAagactagataAGTGaTTAaga ===2==== ***3**** |
|
In the above example the region marked with ---1---- represents a single-sequence window in an unaligned region; the two regions marked ===2==== represent one window spanning two sequences in a conserved block; and the two regions marked ***3**** represent an inconsistent window (because the gap in the first sequence damages the alignment of successive bases with the second). More complicated inconsistencies can arise when there are more than two aligned sequences. We have two options to deal with inconsistent sequences: −D 1 splits them into smaller, consistent windows (in the above example, the two ***3**** regions will become two distinct single-sequence windows); −D 2 disallows such regions altogether (thus assuming that genuine motifs are vanishingly unlikely to include indels). While we are not discussing the scoring here, it is worth mentioning that the scoring involves a "relatedness parameter", an estimate for each sequence of the probability that a base is unmutated from its ancestor; this is supplied via the −H and −L parameters (see also the −G parameter). The benefits of our strategy lie not just in better scoring of phylogeny but in reducing the search space by blocking conserved motifs together. Thus, even if the relatedness parameter is not known very accurately, a rough guess may be quite adequate. In general, for moderately-conserved sequences, values between 0.3 and 0.6 are fine; very high values (high assumed conservation) may excessively penalise mismatches in conserved blocks, while very low values may artificially boost scores of "accidentally" conserved but non-functional blocks. |
|
The moveset is designed for detailed balance maintenance, ergodicity, and good convergence. To this end we implement four kinds of moves: |
|
Window-shift move (−w) |
|
This move picks an already-coloured window that is not the only one in its colour, colours it zero, and then samples from all non-blocked colour-zero windows to replace it, assigning it any of the available colours (not colour zero, and not a new colour). It can be thought of as a "shift+recolour" move. It preserves the total number of colours and the total number of coloured windows but not the detailed number of windows per colour. Under repeated iteration of this move combined with a simulated-annealing strategy, one converges rapidly to a good set of motifs. |
|
Colour-change move (−c) |
|
In the default configuration this move is not performed; it is useful only when a "prior" of fixed number of windows and colours is undesirable. It picks a window (whether coloured or not, whether blocked by an already-selected window or not); if blocked, does nothing; otherwise, recolours it, sampling from all possibilities (zero, an existing colour, or a new colour). The move’s sole purpose is to alter the number of colours and number of windows. It has poor convergence and should be alternated with the window-shift moves. Also, using these moves tends to proliferate the number of colours and the number of selected windows (simply because there are more states with N+1 selected windows than with N selected windows, up until N begins to approach close-packing). This is not necessarily a bad thing (if a window does not fit in an existing colour, this move allows us to assign it a new colour) but the user should be aware of it, and control it with the "chemical potential" (−p) option if desired. |
|
Global-shift move (−s) |
|
This move picks a colour and samples ways to shift every window in that colour uniformly by a constant amount. This is necessary because one can otherwise get stuck in suboptimal configurations that are shifted from optimal configurations, and cannot recover in reasonable sampling time via the previous single-window moves. |
|
Maskbit-flip move (−k) |
|
We maintain a maskset for each colour, which is a bit for each column which may be 1 or 0. If zero, we choose not to score that column. This move picks a colour and a column at random, and does a Metropolis flip of the mask bit for that column. This can be useful with long partially-fuzzy motifs, such as often occur in bacterial sequences; but it is off by default. |
|
By default, the program follows an anneal+track strategy of finding motifs. That is, by annealing it finds a candidate set of motifs, which it assigns into numbered "clusters" of sites to keep track of; then it samples for a long time (100 cycles by default, each cycle containing several moves of each type per window), maintaining statistics of how often each window in the system is co-clustered with one of the tracked clusters (or the best current approximation to that cluster). We find it in general the best strategy to somewhat overestimate the number of types of motif (colours) expected to be found in the system, and be conservative during the annealing stage about the number of windows per colour. We would like to find a few strong candidate sites in each colour, and not pollute the cluster to be tracked with dubious sites; additional colours are harmless, even if the motifs they represent are spurious. The default options thus turn off colour-change moves and use conservative numbers of windows per colour (around 1 motif per 250 available windows per colour); one can adjust this if desired with the −I option, and turn on colour-change moves during annealing with the −c option. In the tracking phase, general, we find 100 cycles good enough to get a reasonable set of statistics, but if desired this can be increased (or decreased!) with the −S option. |
|
The background model assumes the sequence is generated from an N-site-correlated Markov process; this gives a good estimate of the actual number of times a given string occurs in a large intergenic sequence, provided the required conditional probabilities were measured from the same intergenic sequence. The user can optionally specify an auxiliary file containing background sequence; otherwise, background correlations are computed from the input file directly, but by default downweighed with a pseudocount of uncorrelated single-site base frequencies. The simulated anneal has three phases: a transient equilibriation phase, a slow cooling ("anneal") phase that lasts by default 100 cycles and slightly lowers the temperature at each cycle, and a brief "deep quench" phase that samples for a while at almost zero temperature. Options are available to set the number of moves in each of these phases, the starting temperature, and the temperature increment. Several other options (turning off matches on the other strand, looking for symmetric motifs, looking for dimers, various initialisation options) are discussed in the phylogibbs(1) manpage and do not need further discussion here. |
|
The phylogibbs(1) manpage (for usage and detailed
command-line options) |
|
The PhyloGibbs algorithm was developed during 2002-2005
by |